EST 513785 is a singleton


Sequence

>513785 (1 EST) Length=393 GATTTAGTCTTGTTACAATCCTTTGAATTACCCTCTGCCCACACTTTCATCTAAAGAAGTAACAAATACTTGGGAGATGA TAGAATCGTCGTCTTCAGGATGGGAAGTTTTCAAAGAGCCCAAAGGTTTTATTAAAGTTATTGAAGTTCTTATAGCAATC TGTGCATTTGCAACAACGTGTGACTTCTCGACCAGTGTCAAGCTAAAGTATGTCTGTCAGGGTAACGGGTCATATACAAA TTGGGGTGCCAAATTTACATACCCCTTCAATATTGACTCCATCGTGCTTCCTCAATGCAATGCTGCGGAGAGTAAACACA TGTATGGGAATTTCGCTGCAGCAGCACAGTTTTATGTATTTGTTGGTGTCTTAACTATGCTTTTCTGCGTTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 513785: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5137851445038W06818SMEST0454Schistosoma mansoni, adult worm, Gloria Franco


Date: 13:25:57 on Wed 22 Nov 117.