EST 513786 is a singleton


Sequence

>513786 (1 EST) Length=386 AAGACTTTATGGTGATTTCTCTGGATCTCCTAAGTGGTCTTATGGAAGGTCTTGGATCTCAGATGGAACATTTAGTATCA AGTAGCCCTTTGGTAAAGTTACTGTGTGAAGCAGCTCAAGACGTCCAACCAGACGTCCGCCAGAGTAGTTTTGCTCTCTT GGGTGACTTAACAAAGGCATGCTTTGCCTACATCCAGCCTCAGATTGGTCAGTTTATGACAATTTTGGCTAATAATCTCA GTTCTGAGCATATATCTGTTAGTAACAATGCTATTTGGGCAATCGGAGAAATTTGTATTCAATTGGGTGAAGGGATGACA CCGTTCGCTTCTTTGTTCATTCATCCCTTGATAGAAATTATCAATCGNCAAAGTACACCTAAGACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 513786: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5137861445039W06819SMEST0455Schistosoma mansoni, adult worm, Gloria Franco


Date: 21:38:14 on Mon 20 Nov 117.