EST 513789 is a singleton


Sequence

>513789 (1 EST) Length=210 GGGTTTTTGCGGATTTCTTCTTGGTTGAATTTTCAATTGCAGATTAGTTGGCTAATTTTAGAAGGTTTTAGCACGTTGGA TTTTAAGGGTGGACTTTTTAAAGCAAGTCTGTATTTATTCACGTGTCTAGTTACAGTTGTGGAAACTTTTGGTATGATTT TAAAGTCTTTCACCTGTCATGAATACTGTATTTATGGGGGTATTTTTTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 513789: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5137891445042W06822SMEST0458Schistosoma mansoni, adult worm, Gloria Franco


Date: 20:58:11 on Wed 22 Nov 117.