EST 513792 is a singleton


Sequence

>513792 (1 EST) Length=220 TAATTTCTTTACCCTGTTGTCTCGCTCCTTGGTAGATTGTTTTAAATACCCGCTACAAAACGTATCACCAGTTTTGACGT GAATCAATCGAACACTGCACGTTACGTATATTTGAACTGATGCCTAAGTTTATATCTGAAGTAGATGTGGAAGCTAGAAA AAAGATACAGGAGGCTGAGGGTATAGTTGAAGCCCCTTATGATGCCAGATCTCTTTATGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 513792: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5137921445045W06718SMEST0461Schistosoma mansoni, adult worm, Gloria Franco


Date: 19:26:44 on Sun 19 Nov 117.