EST 522103 is a singleton


Sequence

>522103 (1 EST) Length=317 CTTTTTCCTTAATTAATGGAACNAAGAAGCAAAGGTGCAAATACATAATGGTGGATGGTGAAAATATCATTGGTTTAATC ATTTCCTGATCACATTTGTGTTTTTCTCTGTGTTGTATGATTTTNCTCACACTAAAAGGTGCAGGATAAATCATCTGCAA AATAGTACGATCCGGATTATACGTNGTGGGATATGCATGTGTTGCATATTAACATTCCNCCCANTGTTTAGAACTTAGGT TACATAGAACTCTCTTCCTATCAAATATGTNGGCTTTAAGACATCGCCACCTACTGTTGTATCANACAAGGATTTNT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 522103: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5221031289175W15135SWAMCA481SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 4:13:26 on Thu 23 Nov 117.