EST 525166 is a singleton


Sequence

>525166 (1 EST) Length=303 CTGTGACAACTCACCAGTAAGTACTAGTAGCAATGTGCAATGGCGTNCTTCTGGTAAAACAGGTAGTACACCAAATTTGA CTCAATTAAATAATGCCACAGCTGGTAATGGCGATGTGACAGAAATAAAATTAAGCAAGCAGCGTTACGATCGAATGCAA TTATTGAAATTACGTNCAGCTGCCGGATATTTGGATTCGAAAACGACTGCAACCATATACGANCTCGAAATTGGACGTNC CCAGCGTACTAATGTACTTTAAATNTTTATAATNAACACAATTTGTAAGAANTTTCATNCAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 525166: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5251661293872W18198SWAMCA643SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 8:24:7 on Thu 23 Nov 117.