EST 525179 is a singleton


Sequence

>525179 (1 EST) Length=391 CTTAGCGGAATACTACAGTGATGATGAGTCACCATTTAGAAAAAATTCCGAGGAGGAACAGAGCCTGAATAATAGCGATA GAGAACAAACATCAAATGAAATAAATAAGGAGATTCAGCGAAAAGAGGGACGACGAGATTCGGAATACTGGACAGATGAT GCAGCAAATGGAAGCTCGTCATCGAACGCCGACTCGAGTGTCGAATCAGAAAGTAGAATGATTGGAAGCGTTAGTTCATT ACATCCACCTCCATTTAAGAAAGCACTGATATCATCTCCAGAACATTTAGTGCAAAATAATTCTGGCGCAGCAGTATCAC CATCACAGAATCGAAATCGACCACTTACTTCGAAAAGCGCACTTTACATTACACAAAGTCAAGACTTCGCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 525179: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5251791293885W18211SWAMCA658SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 12:30:27 on Sun 19 Nov 117.