EST 530430 is a singleton


Sequence

>530430 (1 EST) Length=401 CAGANTGAAGCATTAATGGATACTAGTAACATTTATAAAACAAACACAACAAACATTTGAATCAATTTCTGGCATCGAAC AAACATTTATTTGTCCTAAAAAAGGATGGGATTTNACAATAAGACATTCNCCANNTAGATTTGCACGTGCTAAAAGTNTT GTGNNGGTTATATGTAAAAANTGTNCACAANCTGGACATCNAGANTTGCTTANTATGTNACTCGAACANANTATCACAAN GGATTTATNAACATTAAGCAAATTTACGACANGTGATGGAAGTAAANTTGTTGGAATGAATGCAAAAGAATTATTGAATG ACTATGGGGCGCAAGTTGGACAACGNTCGNCACTACTNCATCCGCATGATNGCTGCTCAGNAATAGCTCAACAAACATTT G


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 530430: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5304301300180W23326SW3ICA1455SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 16:38:22 on Sat 18 Nov 117.