EST 530442 is a singleton


Sequence

>530442 (1 EST) Length=216 TAGCTGTCGGCTATTCGCTTATTTCACATAATGATCGATGATCAAGCTTTAAGTTTTCTTTCTGTTGCAGTTGAATAAAA AACTTAAAGGGTAAGAAAAAGTTGTGGGAAATAATGGAATTAAAATTTTATAAATATCAAGTATTATTGCTGAATACATC AGTAGGTCCAGGGTTAATCATGTACTGCTGCTGTTAACATAGTTTCGACATATAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 530442: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5304421300192W23338SW3ICA1472SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 10:54:36 on Tue 21 Nov 117.