EST 530444 is a singleton


Sequence

>530444 (1 EST) Length=400 TTATAATAAAATTATCGCGAAACGACGACAAAAGACTGAATCAATTATAAAAAATGGTGATCAAATGATATGTGATAAAA AAACAGAATGCAATAAATTTTCACGAAGAAATTCATTCCGTTCAGCAAAAATAAGTAAAGAATCACCTGATTATTCATAT CTTAATATGTTCGGAAGTGTGAACTTACCTTAAGATTTTTNNCCCGATAAATTGTAAATGTTTCATTTTCAAATAGCCCG AAAAGTCATTAATATTTCATTGAACTGTAAATAATTGTATCATAGATATTAATAAGACCATTAGATGATGTTTTTTTTCG AATTTCGAAAATTATGGATAATTTGANTTCACTACGGTGCAAATAATTACTTTAGCTATTGGGGCAGTGTCGCTTATATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 530444: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5304441300194W23340SW3ICA1474SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 2:35:43 on Wed 22 Nov 117.