EST 530445 is a singleton


Sequence

>530445 (1 EST) Length=370 CTCTCGCAGCAGCAGCACTAACCAACAGTGGCATTTCTCACAAGGTGGCCTTATCTCCACCAGTTTCCAGTTCTATTCAG TCACCAGTTATTGCTACTACTAGTAACACTTCCACTATTTCCGCAGTGATCCATAATGATCTATTATGCAATGATGGATC CGAATTTGTGTGTGTTTGTCAACAGAATGCGGGTAATTTACTAAAATCCTACGTTCTATGCAATGAGCTCATTGAGCTGG ATAAATTGCCGGTAATTGAAATGAACATCAGGCGTGTCAATTTAAGTGCTCGGTTACACACCAATGAAACCTACGAATCT TATTTTANACGTCGAGTTGCAGCTGTTGTAAGTAACTACTGCGAGCAACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 530445: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5304451300195W23341SW3ICA1475SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 15:11:59 on Thu 23 Nov 117.