EST 530455 is a singleton


Sequence

>530455 (1 EST) Length=380 GCTTCTTGTTGATGCTACCTTCGCGATTGTTCACGTCTGTGCTTTCAAAGTTGAATACATCATGGTACCGAGTAATTGAT TCTACACGCTATATGACAAGTTCTAAGGAAGTTGATACGGNTGAAACAATTCCATCTGCATTGGATGCTAACGATAATTC AACTGTTGANAGTGATCTATCAGATGCAGTTATGGACACTGTTAGTAAGGAACGGCTTGCCTTACCTTACAGTCAAAAAG CATTGGAAACATTAAAATTAGACAAATATCCGTACTATGTGGAACGTGAATGGTGGAAAGATGGTAATAGGATGACATTT TGGGTCAACATGGCGAATGAAACGAGATGTCAAAAGGCGACATTTGCTTGCTGAACTTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 530455: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5304551300205W23351SWAMCA495SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 1:24:0 on Mon 20 Nov 117.