EST 530466 is a singleton


Sequence

>530466 (1 EST) Length=396 AAGTTNGAGAATTTCAGAGAGATATGGATATTTTGAGAGCAGTACAATGCTGGTAAACACGATGTTGCTATGCCAAATTC CGCAGGCGATAATAATTGGGAAAGGATAGAAGCTAATGCTGAGTTATTGGGTGAAGGCGATAATCCTAATAGAGACTGTG ATGTTATTCGTGAATTCTTCTCTTACATATTAACTCGCTGGGGTAAAGCATTGAATGCTCGCGATGAAGTTGAAAAAAGA TCAGCAGAAGGTAAATTAGCAGCAACGATGCATAAACAAACAATGGAACATCTTCGTCCATTAATGAAAAATCTGGAGAA ACACAATGTAAATGCTGACATCCGAGAACATTTGATCAAAATTTGTCGTCTCATCATAATTGATCGTGATTACATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 530466: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5304661300216W23362SWAMCA513SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 9:4:12 on Tue 21 Nov 117.