EST 530488 is a singleton


Sequence

>530488 (1 EST) Length=361 GTTTATTTGGATTTTTAGTAAATAATTATGTATTGTAGTGAAGAAAAAATTTCTTTTTTTATTTAATATTAGTTAATCTA TAATTTAGTCAATTTTGGGTAACCAATTTGGACAGATAAAGAAAAATTTNGAAATTAACAAAGCAGTTTTTTNCAAAAAT AAATTGATCAATTTACTGGTTTAAAAAACCATTTTTTATGATTCGTNATGAAATTTTAAAGGGGACCCTGATGATTCACT TTCTGCAACTCATTCCGATCGAAACGGACGCTTTGANGTGAGTGGACAGGAAGATGAAATAGGCAGNATTGAGCCTNATT TGCGCATNACTCATAGCTTGTAATGATGGTGTTATCGATCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 530488: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5304881300238W23384SWAMCA710SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 8:23:14 on Fri 24 Nov 117.