EST 530497 is a singleton


Sequence

>530497 (1 EST) Length=280 TTGAGAAACAGTGTAGCAAATTGGTGATAAAAGACAGCAGAAATCGGGAAATCTGGATCGTTTGGATGCTTTATATCGCC ACTGGGAAAGTCTTAGTTTAAATTTGGAAAAACAAGCGGAAAATTTCGAAAAACGGTTGAAAGAGGAAAGAGATCGAACA GATGCCGAAATGCGAAATGCTATTCCAAATTACTATTCCAAATCATTCATACTGAAATCACTTTTTCACTTTTTATTACC CATAGATCTCCTATATTTGCGTTAGATCAGTTGAAGCAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 530497: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5304971300247W23393SWAMCA719SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 10:7:56 on Fri 24 Nov 117.