EST 536243 is a singleton


Sequence

>536243 (1 EST) Length=384 AGGACATGAACTCAATGAGAAGTTCTAGTCGACTTGAAACATTTTCGTTTTGCATCTTTTGCCAACCGGATTAAGAGTTG GAAGAAACTGAATCGACCACTCTTCAAAACGAGAGAGCATGCAGCATTGGAAATCAATTTCCAAGACAGAATTCACAATG TTCAATTTCAGTCGTGACCACTCCGATTTTGGAACTCTGCTTCCAGCATTTCAATGGAAAAAAAGCATTTATTTCATGTG ATCGTTGTTTTCAAATGCAGTTATCCTCACACCACTATACACCTTGCAAAATCTCATCCAAAATTAAGTGCTGCAAAAAT ATTTAAGCTCTGTGATACAATCTTACGTCTGGATACGTCAGCACTTTATTATAACAACCTTTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 536243: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5362431309123W29139RRAMCA1326SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 19:13:29 on Thu 23 Nov 117.