EST 536249 is a singleton


Sequence

>536249 (1 EST) Length=206 CCTCGCACCGAATTCGATACGAGTTTTTTTTNAGTCCTTTNTTGCATTTGGTTTTCATTNCTATTTTGGTATTTATTAGA TTTTTTGGATTATCCTCGGATGTGGTTGTTTTTTTTATTTGGGACCCTTTAAATTGGGTACCCTTTTCTTTANTAATATT TTTAATTAAAACCATTATATCAGGACACCCCAAGAGTTGCGGGACT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 536249: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5362491309129W29145RRAMCA1323SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 23:39:40 on Fri 17 Nov 117.