EST 540678 is a singleton


Sequence

>540678 (1 EST) Length=359 AGCGGCTGATTAAGCATTGGAATTGATTAATTAAAAAGTTTCCGGACATATTTATATATAGCTGACTTCAAATTATTATG AATCAACAAGGTCCATCACGAATGAAACGATCGCAAAACATGAAGGCTAAACAACCACTTGTAATTACTGTACCGCGTGG CTTATTACGACGTTCATTGCAAGAAGTNATTCCAAGCAAAAATCTACGTATTGGTTTTGTTATCAGCGGAAGTGAAATTA AATTTCTTTCACCAACTGAAAAGTGGGATTGTGATTTGTCATCTATACAACATCTTCCGCATTCCCATTATGCAGGGTTT TCGTAATTTGGGCTCTCCAAGTTCCGCCCATTCCGGGAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 540678: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5406781313856W32826RRAMCA1141SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 19:23:31 on Fri 24 Nov 117.