EST 540680 is a singleton


Sequence

>540680 (1 EST) Length=150 GTTTGAGGTAGGTAAGCTTTTCCACGGGTTTTGGTAATGCGAAATATCTTACAACATTATGAATTACTTTCTCCGTACAA TGCTTCAAAAGCAATTTCAATTGTCGAATCGGCAAACGAAGCTTGTTTATCGCAATTTTTTATCCGCATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 540680: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5406801313858W32828RRAMCA1206SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 16:23:9 on Mon 20 Nov 117.