EST 540694 is a singleton


Sequence

>540694 (1 EST) Length=354 GTGAGATTCACTGCAGACTCAGTGAGGATTCAGCATGCAATGGATGGTTTGATGTATTTTCTGTGCCATGTTGGAGTGAT TACACAGACGTGGACGTGGCATGGCTGTTGAATTCATCATNTCCTAAGTCTTACGGTTTCGTGGTGCAACTGCTTACGGA TGGTGACTATGCTGCCAACTTTGTCACCGCTGGCACGGCGACGAATTCTTTCGGTGCTGAATGATTGCCTCGAAAATGTG GAAAGTCGAGGAGCTGTAGCATTTGTTAGAAATGTGGAACCGATACTGCAGAATGGACCCCAATGTGGCTTCCGTGGTTG CTNAAATTGGCCGCCCACAACGGGGTTTTCCCCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 540694: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5406941313872W32842RRAMCA1221SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 3:50:2 on Sun 19 Nov 117.