EST 544168 is a singleton


Sequence

>544168 (1 EST) Length=353 CTGGAACAGACCAATCGACTTAGTACGGAAGAGTCNGGTTANAATTGCTCTATGGTTAAACAAGGGANTAAATCGGGAAT CATGGATGTGAGATTTGCTGATTACGCGAGTGCCGCACACCACATTTCAGGTCCTGATGGTAACCGAGCGATAATTATGC TTAGCATGTCAGGGGACCNTTTACACAGAGCTCCAAGNAACATGGAGCTGACGGAAATTATTGCGCCGCGAATATGGTAA ATATCTGTGTACAACACCGGAATCTAATTTATAATGTNCCACTAACCCACAATCTTAAACGANTTGNCCACCGATTATTC CGCCGATCGGTTACCCAAGCCCTCCACAATTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 544168: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5441681318062W36316RRAMCA1245SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 20:45:26 on Wed 22 Nov 117.