EST 547705 is a singleton


Sequence

>547705 (1 EST) Length=233 CTGAATAATTTCGTTTGTGACAGTAGCAACGAAATAGTATATAACACATAATAATTTGTTACTGTGATATATCGTACAAA AAAAAAAGTCTATCGGTCTTTNAAATAAGCCAACGGGAACTGTTGAACTTGGGAACTGTCCTTCTTTTNCTGTTGCTGCT ACTGCTGTTTCCAAAGGCTTTGCTCGCCGCTGAATGCTTGGAAGCGATCAGCAGAGACTCTGTTTTCATCATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 547705: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5477051322259W39857RRAMCA152SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 21:49:22 on Fri 17 Nov 117.