EST 547710 is a singleton


Sequence

>547710 (1 EST) Length=210 AAACATTGCTAACNAAATTACAATCACAAATTAAATGGTATCNNNGCTAACTGATAAAAAACGACGTATTCAACAAAAAG CCTGGCTTATTAATACTACAACGTGATGTTCGTGCGTGGTTTTCATTACGTGCGTGGGATGGTNTAAATTATCACCAAAG TACGACAATGTTAAAAGAGGTAAATAGCGAGAATTGGAAAATTACAGGAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 547710: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5477101322264W39858RRAMCA163SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 2:50:48 on Mon 20 Nov 117.