EST 547716 is a singleton


Sequence

>547716 (1 EST) Length=280 TATTGACTTGAAAAATGAATTATTTATTTGGTCCGATGGTTTGATTTTGTTGCTTTTAAATTCNCAAACATCTGCTGATT ATATGATAGATTCATGTAATATGGCATGCTGAGAACGTAATAAATACGTGTGGTACGAGCACACCTCAGAAGTAATTCGA TATCAGTTGGACTTTGTAGAAATGAGACAGTCCGTCTTATCAGTCGTACGTGACACCGTACATTTCAATCGTACATTGTG AATGGGACTGATATAGATGATGAGGACGGATATGATTCAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 547716: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5477161322270W39864RRAMCA179SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 12:40:49 on Tue 21 Nov 117.