EST 547717 is a singleton


Sequence

>547717 (1 EST) Length=257 GGACAGTGGTCTTNNGTAAGNGTNTTTTCTACAGATTTCCAGCGTCGTTCGTGTCAGCTCGTGTCGTATTGAAAAATATC AGTTGGTTCACCGGTAAAAGGATCTGAAGTTCCATTTGGTCGTTTAGGAAGGTGAACACGTCAATTGTTATATGATGGAA CAGTTCATAGGGTTCATTGTTGTTAGAGCACGACGACGCATAGCTTGCACGACGAATCTAATTACGCGGTATCGAAGTCG GTCAGTCGACCAATGAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 547717: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5477171322271W39865RRAMCA182SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 20:41:21 on Tue 21 Nov 117.