EST 559464 is a singleton


Sequence

>559464 (1 EST) Length=664 ACCCAAGTTTGAGAAAAAAGAGTTTAATAATGGCATCCATGTCAGTAGCAAGGAAAGCTCTCGGTGATTTAATCAAAGCA TTCAAACCACTATCAGACAGAGTACTGGTAGAACGGTTTGCAGCAGAGACGAAAACCAAAGGTGGAATTATGATTCCAGA CAAAGCACAAGGGAAAAGTTCTGGAAGCAACAGTAATTTCTACTGGACCTGGTGGACGTGATAGTAAGGGAAATTTGGTT CCGATGACTGTTCAGGCAGGAGACCATGTTTTGCTTCCTGAATATGGCGGCACAAAGGTTGTTGTTGACGAAAAGGAATA CCACATATTTCGAGAGGCAGATATTCTCGGAAAATTCGACCAGTAAATATCGACATGCGTTATGAATTTTTAATGTTACG ACTAATATGTTATTTTTACGTTTTTTAATGAACCATATTTCTCCCATAAAATGAGCTCCATTTCAACTGTTATGATATTT AACTAGANAATTCCTGGACNATGATCTTAAATACTTATTTGAATGTCTGTGCGAAGATCCCAGATATCTGCCCCAGTTAG GAAATCCCCGGAAAAATAATTTCAANGAANGANCCGGTTGTTTTGTTCCCCCTTANTTTATTTCCCNATANCCCTAAGTT TACCTTAATGTCCCCGTTTTNNGN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 559464: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5594641345285W51572AS4SLC756T3Brugia malayi L4 JHU93SL-BmL4


Date: 11:39:14 on Fri 24 Nov 117.