EST 559494 is a singleton


Sequence

>559494 (1 EST) Length=534 CCTTACCAAGTTTGAGATTGTACAACAACGACAAATGAGTAGCGACACGAAATATTTTGTTCGTTTACGGATCGGGCATA AATCCGAAATGCTCGATCGTCCAACATCGACTGGCATGACTCATAGGTGGACAGTATTTGTACACTCCTTCAGCGGGATG CCATTTACGGATCGCAGTTTTATTTCAAAGGTGTGTTTGAATTGCATCCCGATTTTTCGTCTCCACGACGAGTTGTAAAA GAACCTCCTTTTGAAGTAAGCGAATTGGGTTATGGTGGATTTTCGATTCCAATTCATATCACTTTCACAGGCGCAAGCAA AGTCTACAAATTAACATATGATATGAATCTTGTATTAGAAAAGTATAATGAACAGTTTATTACTCAAACCATCGAAATGA AGCAACCGTCATCATCGTTTCGGGAATTGATTTTAAAATATGGCGGGGCTAAGAAGGATTCTGATAAGCGCAAAGAAAAA CATCGATTACGGAAAGGAACAATAATTCGTCAGAAGAACCGGCTCCGAAAAGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 559494: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5594941345315W51602AS4SLC873T3Brugia malayi L4 JHU93SL-BmL4


Date: 10:2:5 on Wed 22 Nov 117.