EST 559637 is a singleton


Sequence

>559637 (1 EST) Length=457 GGAATTCGGACGAGCTGACGTCCTACACGGAAAGAACGGNANCTTTGTTGCTCANATATTTTCCATTTTACTTATTTNAC GCACATCAGTTNGTCGCCATNCAAAATCAATTCCGGTGCTGTCAACAACACACATGGTGGTAGCAGGAGAAAAAAGTGTG GGTTGNCGAATTGATATGCGAATTGNTATAACCGGNAGGGCCTAAACAGATAGGCCCAGCCTTACTATTATTGCATTCCT ACTGAAATTTATGATGATACTANTACCTCGTTACTATTCACTGCTGCATGCTAACGGTACGCCGATCGNCAACATTGATG TCGTTGGACAGTCACCGGCCACCTCTTCTGCCGNTTTATTCAANACAANGAGGAAAATGGTTCTGTCTTCGATGAAATAG CAAAGAAAGCATCATTTCATTGCATCAGAACCTTACATNGCACCGCCATTGTTTCTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 559637: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5596371349143W51728SWAMCA608SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 22:9:12 on Fri 17 Nov 117.