EST 559638 is a singleton


Sequence

>559638 (1 EST) Length=89 GAATTCGGCACGAGGCATTTCATGTTTTAACCAATTTGTAAACACACCGGTTTATGTTAGTTATTGCTGATGAATAAATT TGGGAAAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 559638: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5596381349144W51715SWAMCA610SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 17:57:54 on Fri 17 Nov 117.