EST 559643 is a singleton


Sequence

>559643 (1 EST) Length=61 GGCACGAGAAATTGGAACAATACAGAGGAAGATTAGCATGGCCCCTGCGCAAGGATGACGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 559643: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5596431349149W51720SWAMCA616SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 3:45:3 on Sat 18 Nov 117.