EST 559645 is a singleton


Sequence

>559645 (1 EST) Length=339 GGAATTCGGCACGAGCCCAAGTTTGAGGTTGATCATATAATTTATTTGCTGAATATGTCACGACGATCAGACCCGCTCGA TTGTAAAGTATACGTTGGAGGTTTACCACAGGATGCTACATCGCAGGAGCTTGAAGATGCATTCAATCGTTTTGGTCGTA TACGTAAAGTTTGGGTTGCCCGTCGTCCTCCAGGATTTGNTTTTGTGGAATTTGAAGATGCCCCAGATGCTGAGGATGCT GTAAAAGCTTTGGATGGAACAAGAATTTGTGGTGTACGTNCTCGTGTAGAAATTTCACATGGTCGGCGACGAAATGGTGG TTATGGAGGGGGTGGAGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 559645: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5596451349151W51722SWAMCA618SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 21:24:48 on Fri 24 Nov 117.