EST 559660 is a singleton


Sequence

>559660 (1 EST) Length=430 GAATTCGGCTCGAGGAAATCTTTAAAATCCCGTGAAGGTACNACAAGGAAAATCAATACTGTCAGAGGACTGCGACTCCG ACACAGGAAGCGGAAACGAACGTTTCATCAATAACCGAAATGTCGGAAGTTAAAACAGAGCAAATGGAAGTTGACAATGT TAGTGCAAAACGAAAGAGTATGACGACTCTTCCACAGAAAGAAAAAAAATCACGACAGAAGTCACCGCGGCCTAAATCTA AATCACCGAAACCAGAAACTTTTCAAGTNGATAATGAAAATACAAATAAAGACAGGATGATGAGTTGCACTTCCAGCAAC AAAGCAGGTCATNCTTCAGCAGCAAAAGCAAGCGAAGTGCGAAAAATNCCGAAAGATAGGTCTTTCAANGTCGGATGGAA ATTGGAGCACAAGAATTTTGGAAATGAAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 559660: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5596601349166W51738SWAMCA635SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 4:25:44 on Fri 24 Nov 117.