EST 559665 is a singleton


Sequence

>559665 (1 EST) Length=259 GAATTCGGCACGAGAGAGAGATAGTTCTCTCTCTCTCTCTCTCTCAAACAATAAGTTACAAATTATTAACAGATTCAAAT TTAATNTGAAATGTACAAAATNCACTGAATGCAGTAATTGGTGATTAGATGTTGATGCAGTATGAAAGAAAGAAAGTNTG GTGTCATTTAATTANCCAAGTGTAGTTTTTTTTTTTACTTAATTACTCAATNNCCAATTGTAANTACTGTCCNCGCCCAT NTCATCAACTNTCATTACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 559665: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5596651349171W51710SWAMCA680SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 9:8:42 on Tue 21 Nov 117.