EST 567890 is a singleton


Sequence

>567890 (1 EST) Length=396 CCAAGTTTGAGGCTTTCACAAAGTTGGAAGGACTTACTGTACAGGATGATGAAAAAATGTATCGAACCGACCCAAGCAGA TGAAATGTACTCTACGACAAAATGTGAACTGTATGGATTAAAGGGTTGCGATGGGACAACTAATACATCTGATTCTGAGG CANAATTGATGCATGCCTCAGGAAGTCCTTGAGGAGTAAACTTCATGTGCACGACTATTATTGATGGGGCAGAATGGAGA TCCCAGAATTATAATCTGTCGATGTCTCTCCGGTATATTTTNGATGTCACTCATAATTCTCGAATCTCAAGTCTGGTCTG TGAGACGTGTACACGTGTCTAGTTTTTATTGATTGATCTGCTCAGTCGATTGAGTGAAAGCGCGGCTCTCGTCACT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 567890: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5678901366638W59847SWAMCA940SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 22:57:57 on Wed 22 Nov 117.