EST 567914 is a singleton


Sequence

>567914 (1 EST) Length=100 CGTCCATTTACTCATACACAATATGAACGATTCCTCGTGGCTGCTTATCCTTATTATAGTAGTGCTATATCAATGATGAT TGGCCTAATANCATTAGTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 567914: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5679141366662W59924EST000442S. mansoni cDNA


Date: 14:11:42 on Fri 17 Nov 117.