EST 567918 is a singleton


Sequence

>567918 (1 EST) Length=172 ACGAGTGGAAATGAACTGGAGAAAAATGGAAGTAAGCTCACTGTATTTGGGTTATGGAAACACACTGTATGTATATTTCG TGATACCAATCCCTTACGTCTGTGTGCACACCAAAAATATACTTCGATTGGTTTTTACTTCCACATGATTGCACCTTCAT TTATGATGCTTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 567918: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5679181366666W59928EST000446S. mansoni cDNA


Date: 14:38:38 on Tue 21 Nov 117.