EST 567919 is a singleton


Sequence

>567919 (1 EST) Length=133 CTACATTCAAATATATTAGCTTAATTAATTGAACTGAACAAATTTTGTTAGAATGAATAAATAACTACTTATCACAAATA TTAGTTGATCAAAGCTGAATATTTCAAATCATGGATTGAATATATTACTACTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 567919: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5679191366667W59929EST000448S. mansoni cDNA


Date: 6:18:30 on Thu 23 Nov 117.