EST 567920 is a singleton


Sequence

>567920 (1 EST) Length=112 TCTGAAATTCTCGGAACAGGATATCACGGGACTGTATTTGTATTCAGGTGTTTTATTGTTCAGTACATTTACGATTCCTG TTCCAGTCGAATTTGTTGGTGTATTTAGTTCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 567920: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5679201366668W59930EST000449S. mansoni cDNA


Date: 10:30:7 on Mon 20 Nov 117.