EST 567921 is a singleton


Sequence

>567921 (1 EST) Length=175 TATAATACAACAAACGGTTGTCAACCTTATGAATTTCCACCGTGTGAACACCATGTGATCGGTCCATTACCTTCATGTGA TGGTGATGTTGAAACACCTTCATGTAAACAAATTGCCAACCAGGATATAATATACCATATGAGAAAGATAAATGGTACGG TGAAAGGTCTATCGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 567921: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5679211366669W59931EST000450S. mansoni cDNA


Date: 23:45:13 on Fri 17 Nov 117.