EST 577146 is a singleton


Sequence

>577146 (1 EST) Length=503 ATTATAGTTAACAGCATATTTGGATGGCTCAGCGATTTATGGTTCCACANAATGTGAAATGAAAGAATTGCGCACTTTTG TTGGTGGTCGGCTTAATAGCACAAATCTTGGCATATTCAATCCAGAAGCATTACCACAAGGTGATCAGGAGCAGGATTGT CGTTCCAAACCGGATTTCATGTGTTTTGTTGCCGGTGATGAACGGAATAGTCATCANCCGGGTCTAACATCAATGCATAA TATATTTTTACGTGAGCATAATCGAATTGCTCGAAAATTAGAAGAAATGAATCCATTTTGGAATGATGAACGAATTTTTC AAGAAACAAGGCGAATTGTAGGCGCGGAATTTGCACATATAACTTACAATGATTAATTTACCATTATTACTTGGAAATCG ATTAATGCATAAATATGATTTAAATACTCCTAAAATTGGTTACTATCATGGTTATGATGATCAATGTGATGCATCAATAT CACATCCATTTGCACATCTGCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 577146: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5771461378358W69058SWAMCA791SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 1:35:44 on Sun 19 Nov 117.