EST 577155 is a singleton


Sequence

>577155 (1 EST) Length=131 CGGCACGAGGAGTAATAGTTTTCATCCAAATAGTAGTTTCCGTCGATGTTAAGCTATTTAGTTATTTGACATTTCTGTGT TTGTATTGTTTGCATTCATAATCCATTCCAATAAAGAAGCATGCAGTTAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 577155: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5771551378367W69067SWAMCA993SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 2:22:6 on Mon 20 Nov 117.