EST 580074 is a singleton


Sequence

>580074 (1 EST) Length=431 GTGATGCATCTTAGACGTTGATTCGGTTCCGGTTACTACAGTTTCTGATACATCCAATATTATTTGCGCTAATTTACGGA AAAACGGTTATGCAACTTTAGTAATTGAGCAGCCAAATGATCCATTAGCAACAGCACATGTTCGTCTAGCGCTAATGACC GAAAAATCGATGGAAATAGATCTACCACTTGCGCCTGATGTAATCGATATCTGTCAACAAGAATATAAACGCATGAAACG AGATCCTGATTTACCACCANATCAAAATATTTTAAAAACTCAGGGTGATAAACCACGTCCACTTCATCACGAATTCAAGT AAATGAGAAAACGGAAGATGTGCCGATTGCATGTGATGATANTCCGGCATTACTGATGAAAGTGCCAATATTGTATNCAT CCGACAAACAGGANTNTTTTCGTNGTCTGAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 580074: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5800741382075W59861SWAMCA732SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 2:33:32 on Sat 25 Nov 117.