EST 580085 is a singleton


Sequence

>580085 (1 EST) Length=130 GCAGCGCATCATGTATTACCACTGTACGTTGAAAGGAAAGAATCAGTTGATTCAGCTCCCAAGTAGCTATACATAGTAGT CGCTATTGGGTGGCNATCGAAATCTACTNGTATGACACCAGTNGTCGGTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 580085: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5800851382086W59872SWAMCA749SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 1:22:29 on Mon 20 Nov 117.