EST 580106 is a singleton


Sequence

>580106 (1 EST) Length=316 GTTATAATCCATAGATCGCTTAGTTACTTATTATAATCAGTCTCCAAATCAAGCCAATATCTAAGTTTCAAAGTTTATGC TTTCATTAGTAGCTAAAGCAAATGATAATGGTTCGGGCAGAATTATAATGAATAACATTGTTTANTTCACTAATTAATTC ATTATTTATGCTCCAAGACACATTCTAACTTCTTTTTTCTAATCTCATTCANCACTTTTCTATTTTCTGCTTCTTTTCCA TTTGTNTTCTCATTTAATAAGAGTTGTTAGNACCTCGAAAGATAAGTAATATAATTGTATAAGTAAAAATCTCTCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 580106: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5801061382107W59893SWAMCA771SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 0:32:40 on Fri 24 Nov 117.