EST 580114 is a singleton


Sequence

>580114 (1 EST) Length=483 GTTTTGTGATAGTCATGTCAGATGTTCTTGGAAAAGATCAAGATGCAAAAAAAACCGAGACGGGAAAAGAAGGTTCCGGC AGGAATGCTACATCGGGGGGAGTATCTGTGCTCGGCACTACTAATCAAGCAGAAAATGATAATTCGGGTGTTCTGTCTTC GACAGTTAAAAACCAGAATTTATCGACAAATGCTATGCCAATTTCGAGAAGAGTAGTTCCAAGAAAAGATTACAAGCTAA TCCAGAAAGTGGAGGAAAAAGTAGTGCAAGAAAAAAGTATACGAACTGGAAGTCCTAGGCGCCGAAGGGCGACATTGTTA CATGTGGTTCCAATAAACGATTTACCAGATGTTGCGCGTGTACAACTACTGCTTAGCAACATTAGTGAACGACCGTTGCA GGATCAAACTGAAAAGTGAACCGGGTCCAGATNTCTCTTGCACTGNCAAGNGCANGAGGTCATATTAATGCGCATTGNTC AAN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 580114: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5801141382115W59901SWAMCA779SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 4:16:31 on Mon 20 Nov 117.