EST 580122 is a singleton


Sequence

>580122 (1 EST) Length=384 AAAAAAATGGAGTTTAGNCCATCACCCTATTATATCTGAGCCTAGGTGTGTTAGGTATTGAGCGGGATTAGCCCGTANAT GANTATAGGTATTCGCCGTTCTTTACCATCCGTCTCNCATATCTATNATATNTCCCCTCCCCCATGGATAAAGGATCTCT TNNGGGAGGATGTCAGCGNCCAGTACTCTTTTAATGATCATCGGATATTNAGTCAAGGGTTCGTTTATTTCTATTTAGNN CAATTGACTCCATNTTCTTCTATTNNAGGGAACTTNGNAGGGATTCTTCTCTNTATCCTTCGGACTTGGNNGGNTGGGGT TTGGATCTCCTGTCGGCATTTCGTCTCCCTGATTATTTAGGCATCAACGGTATGGCTAGTTTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 580122: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5801221382123W59843SWAMCA787SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 15:38:53 on Fri 24 Nov 117.