EST 585871 is a singleton


Sequence

>585871 (1 EST) Length=213 AAAAAGCGTCATTTTGATGCACAGAAAGCAGAAATATCTCGGATATTTTTGGAAAGATCTCCCAGTTGTATGGTTTTATT GGTTCGTAGTTATGGTCTCTTAGCTTTGGGACAGTCAATTGAGGAAGCATGGTTTATTGCTTTTACATCCATGTTAGCGT GCGAGCAGTTTACGTTTGGCGAGCATTAGTCTGGATGAATTGGTTATCCCTAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 585871: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5858711377928U58051SMU58051Schistosoma mansoni adult worm Lambda ZAP II library


Date: 3:49:28 on Sat 18 Nov 117.