EST 585877 is a singleton


Sequence

>585877 (1 EST) Length=314 CAATTTCCATCCCGAGATTGTCTTAGTCTGAGGCTTGTGCCTCCTTATGCTACTGTATGCTACCCTAGTATATAAAGTAT TTTCTGGCTAGACGCGAACCTCCACAAGTCAAAAGATGATTCCGGCTTTGATCTTTAGTTTTTTATTACCTTTATCGTTG ACGTCTGTTAACCAGACATTTTCCGTGGTCAACAATCAAGAATCCGGATTTCACGTACGAAACGAAATACTTTTGGACCA GGGTGGACACTTTTCTTTCGTAAACGATGAAAAGTTCTCATCAGGGATCTAATTAACAACGAGTCGGTTACTCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 585877: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5858771377938U58059SMU58059Schistosoma mansoni adult worm Lambda ZAP II library


Date: 7:1:14 on Tue 21 Nov 117.