EST 585878 is a singleton


Sequence

>585878 (1 EST) Length=398 ATGAAGGCTACAACTAGAAGGGGGAATAATATCGCGATTCTTTATATGCCTATCAATTCGTCATCTAAGCTAACATTCTT GTTAAGCATGGAAATGCCGTGGACTTGGGTCTGATGCTTCACTTCATGTATGAACTGGGTAGCAAGTTAAACGTTAACAT CATGTGTTACGATTATTCAGGCTATGGAGCATCTTCTGGAAAGCCATTGGAAAAAAACCTTTATGCTGATGCTGAGTGTG CACTAAATGTTTTANGGACGAGNATTCTGTCCCTTTAAACCAAATTGTTTTGTACGGCCAGAGCATTGGGACTGTACCGA CAATACATCTGGCTACTCTTCATCGNGTTGCAGCTGTTGTACTACACTCTCCATTGATGTCCGGGTAAGGGAGCTTNC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 585878: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5858781377939U58060SMU58060Schistosoma mansoni adult worm Lambda ZAP II library


Date: 0:3:3 on Sun 19 Nov 117.