EST 585880 is a singleton


Sequence

>585880 (1 EST) Length=107 GAACTAAGTTCTCCCAGTTTTTATTTTATTTTAACGTAAATTTTTATACCATAAAATTTATTACTTATAATAGACTTTGT ACTAATGGATATTAAAATGAAGTTATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 585880: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5858801377941U58062SMU58062Schistosoma mansoni adult worm Lambda ZAP II library


Date: 6:53:10 on Mon 20 Nov 117.